BMC Microbiol. Prior to this work, obtaining a CLas whole genome sequence was a challenge. Wu F, Zhao S, Yu B, Chen YM, Wang W, Song ZG, et al. Population variation studies using PCR to amplify several genomic loci or short tandem repeats regions might not provide sufficiently high resolution to differentiate all strains from multiple locations8,9,10,11,12. bioRxiv. The Agilent TapeStation system is an automated electrophoresis solution for the sample quality control of DNA and RNA samples. In this study, it costs $500 per sample to obtain the whole genome, which includes $300 RNA probe per reaction and $200 sequencing price. For samples with N1 and N2 Ct vales of less than 30, average coverage was 98.99% (10x) and 96.45% (100x) at a subsampled read depth of 100,000 raw reads (Fig. 3d, Supplemental Fig. A-F) Observed read depth for each of the expected amplicons for the indicated sample amplified with the ARTIC v3 protocol with TruSeq library preparation at a subsampled read depth of 100,000 raw reads. ADS Next generation sequencing technologies have enabled large-scale genomic surveillance of SARS-CoV-2 as thousands of isolates are being sequenced around the world and deposited in public data repositories. 31(22), 36913693 (2015). Gohl DM, Magli A, Garbe J, Becker A, Johnson DM, Anderson S, et al. Genomic DNA was extracted from petiole and leaf midrib tissue using the DNeasy Plant Mini Kit (Qiagen, Valencia, CA). These amplification primers had the following structure (see Supplemental Data File1 for primer sequences): Left primers: TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG . S8. Next, 1 g of each library was hybridized with the SureSelect capture library. Performance metrics for Illumina DNA Flex Enrichment Protocol. The Agilent TapeStation 2200 is an intuitive system for automating RNA, DNA, and protein sample quality control and reliable electrophoresis. It is suitable to analyze size, quantity, and integrity of your samples. Whole genome sequencing can provide precise molecular characterization of the diversity among CLas populations. Eight samples with >1ng/L concentration of target amplicons were selected for downstream library preparation. We could tell you about the benefits our TapeStation systems have to offerbut we thought showing you would be better! To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. PLoS One, https://doi.org/10.1371/journal.pone.0112968 (2014). If you need results sooner, please contact us. The Agilent TapeStation system is an automated electrophoresis solution for the sample quality control of DNA and RNA samples. The system includes instrument, software, reagents, and ScreenTape devices to analyze size, quantity, and integrity of your DNA and RNA sample. https://doi.org/10.1093/bioinformatics/btp698. Previously, the NEBNext microbiome DNA enrichment kit coupled with the REPLI-g amplification kit was used to successfully sequence the HHCA genome from an infected lemon tree with 175pg of CLas DNA per l (roughly equivalent to Cq 2324 using Li 16S qPCR6). Percentage of genome coverage at 10x at different subsampled read depths for WA1 and UMGC SARS-CoV-2 isolates sequenced with different methods. CLas positive leaf samples from grafted trees were collected for genomic DNA extraction. Hundreds of millions of sequencing reads are needed to get good CLas genome coverage from an infected citrus sample, making CLas genome sequencing challenging and costly18. Get what matters in translational research, free to your inbox weekly. Phytopathology. The positive enrichment approach described in this study shows a relatively simple and universal CLas genome enrichment method. Therefore, it could be possible to obtain the whole genome with even lower titer if more reads are used for the sample. Here we describe an all-amplicon method for producing SARS-CoV-2 sequencing libraries which simplifies the process and lowers the per sample cost for sequencing SARS-CoV-2 genomes (Fig. Agilent offers two instruments that are based on ScreenTape technology, the 4200 TapeStation system that enables the unattended analysis of up to 96 samples loaded from a well plate and the new 4150 TapeStation instrument, which analyses any sample number between 1 and 16. Percentage of bases covered across fixed depths of coverage based on reference guided assemblies and estimated with samtools depth. We thank Brandon Vanderbush for conducting QC on the SARS-CoV-2 samples and sequencing libraries. Indeed, this mechanical lysis approach has been widely adopted for lysis of both Gram-positive and Gram-negative bacteria within complex matrices. Bioinformatics. An estimated 10,000 viral genome copies were used as input for cDNA generation. Positive selection (like the SureSelect method described here) can enrich a target hundreds to thousands fold, making it possible to sequence low titer samples. The system integrates an instrument, data processing software, reagents, and ScreenTape devices specific for DNA and RNA. 1). Nat Rev Microbiol. Percentage of genome coverage at 100x at different subsampled read depths for WA1 and UMGC SARS-CoV-2 isolates sequenced with different methods. The Wuhan-Hu-1 SARS-CoV-2 reference genome (Accession number: MN908947) and the human GRCh38 reference genome primary assembly (Accession number: GCA_000001405.28) used in this study were downloaded from NCBI (https://www.ncbi.nlm.nih.gov/). Less than 45% of SNPs in LHCA were identified in SGCA samples, suggesting this enrichment method does not change the pan-genome variability. Agilent 2200 TapeStation The Agilent TapeStation 2200 is an intuitive system for automating RNA, DNA, and protein sample quality control and reliable electrophoresis. The tailed amplicon method we describe represents a cost-effective and highly scalable method for SARS-CoV-2 sequencing. Supplemental Fig. The following recipe was used to set up the PCR reactions: 2.5L template cDNA, 14.75L nuclease-free water, 5l 5x Q5 reaction buffer (New England Biolabs, Ipswich, MA), 0.5L 10mM dNTPs (Kapa Biosystems, Woburn, MA), 0.25L Q5 Polymerase (New England Biolabs, Ipswich, MA), 2L primer pool 1 or 2 (10M). Science (80- ). Size distribution of each barcoded cDNA library determined on the Agilent TapeStation 2200 using the Agilent High Sensitivity D1000 ScreenTape Assay in the nasopharyngeal swab . Paden C, Tao Y, Queen K, Zhang J, Li Y, Uehara A, et al. B) Mean read 1 quality score for samples prepared with the tailed amplicon v1 (2 pool amplification) workflow amplified for either 25 or 35 PCR cycles. Mass spectrometry, chromatography, spectroscopy, software, dissolution, sample handling and vacuum technologies courses, Live or on-demand webinars on product introductions, applications and software enhancements, Worldwide trade shows, conferences, local seminars and user group meetings, Service Plans, On Demand Repair, Preventive Maintenance, and Service Center Repair, Software to manage instrument access, sample processing, inventories, and more, Instrument/software qualifications, consulting, and data integrity validations, Learn essential lab skills and enhance your workflows, Instrument & equipment deinstallation, transportation, and reinstallation, CrossLab Connect services use laboratory data to improve control and decision-making, Advance lab operations with lab-wide services, asset management, relocation, Shorten the time it takes to start seeing the full value of your instrument investment. Nature. 2019;20:8. https://doi.org/10.1186/s13059-018-1618-7. Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. Primer dimer formation in tailed amplicon method. ARTIC v3 amplicon relative abundance. Double-stranded cDNA size was determined using Bioanalyzer high sensitivity DNA assay (Agilent, Santa Clara, CA) and quantified with Qubit Fluorometer and High Sensitivity DNA assay (Thermo Fisher Scientific, Waltham, MA). The integrity of the extracted RNA was analyzed using the Agilent high sensitivity RNA screentape assay on Agilent 2200 TapeStation following the manufacturer's guidelines (Agilent, Santa Clara, CA). S2-S3). Nat Biotechnol. The sample pools were diluted to 2nM based on the Qubit measurements and Agilent sizing information, and 10L of the 2nM pool was denatured with 10L of 0.2N NaOH. The ARTIC v3 libraryprepared with TruSeq library preparation achieved 99.60% coverage at a minimum of 10x and 97.31% coverage at a minimum of 100x (Fig. https://doi.org/10.1186/s12864-020-07283-6, DOI: https://doi.org/10.1186/s12864-020-07283-6. 2.5L extracted RNA was added to 7.5L qPCR master mix comprised of the following components: 1.55L nuclease-free water, 5L GoTaq Probe qPCR Master Mix with dUTP (2X) (Promega, Madison, WI), 0.2L GoScript RT Mix for 1-Step RT-qPCR (Promega, Madison, WI), 0.75L primer/probe sets for either N1, N2, or RP (IDT, Coralville, IA). We use the fragment analyzer from AATI, costs 31303.8, cheaper per sample than bioanalyzer. Springer Nature. The following reagent was deposited by the Centers for Disease Control and Prevention and obtained through BEI Resources, NIAID, NIH: Genomic RNA from SARS-Related Coronavirus 2, Isolate USA-WA1/2020, NR-52285. Genetic diversity of Candidatus Liberibacter asiaticus based on two hypervariable effector genes in Thailand. The findings and conclusions in this publication are those of the authors and should not be construed to represent any official USDA or U.S. Government determination or policy. After trimming and filtering, 4050% of the enriched reads were discarded due to insufficient read length and suspected probe contamination, while less than 5% of non-enriched reads were discarded (TableS3). No we just use an Agilent Bioanalyzer purchased back in 2003. 19(5), 455477 (2012). Curr Biol. Google Scholar. To generate cDNA upstream of SARS-CoV-2 genome amplification, the following reaction was set up: 5L template RNA, 11L nuclease-free water, 4L SuperScript IV VILO master mix (Thermo Fisher Scientific, Waltham, MA). This tailed amplicon method uses a two-step PCR process similar to workflows previously described by us and others to generate microbiome or other amplicon sequencing data [14]. 2020:2020.03.10.985150. https://doi.org/10.1101/2020.03.10.985150. The Agilent TapeStation is used for DNA analysis. For samples with N1 and N2 Ct vales of less than 30, average coverage was 99.92% (10x) and 99.62% (100x) at a subsampled read depth of 100,000 raw reads (Supplemental Tables12). In initial tests, samples with N1 and N2 Ct values greater than 35 yielded poor coverage (~50% genome coverage at 10x) using the tailed amplicon method, did not yield useful data for the Nextera DNA Flex Enrichment protocol, and did not generate enough amplicon template to proceed with library preparation for the ARTIC v3 method (data not shown). https://doi.org/10.1093/bioinformatics/btt593. We benchmark this tailed amplicon method against both the ARTIC amplicon protocol and sequence capture approaches and show that an optimized tailed amplicon approach achieves comparable amplicon balance, coverage metrics, and variant calls to the ARTIC v3 approach. Currently, conserved genomic loci, such as the 16S rRNA gene, are used to define the CLas species but lack the genetic variation to differentiate strains6,7. Bioinformatics. 3c, Supplemental Fig. Targeted genome enrichment specifically enriches sequences of interest within a heterogeneous mixture of DNA samples. Analytical Validation of a COVID-19 qRT-PCR Detection Assay Using a 384-well Format and Three Extraction Methods. The tree with the highest likelihood across 10 runs was selected. The Agilent TapeStation system is an automated electrophoresis solution for the sample quality control of DNA and RNA samples. SNPs were determined based on the alignment profile to Psy62. and S.Y. The Agilent TapeStation system is an automated electrophoresis solution for the sample quality control of DNA and RNA samples. C) Percentage of sequencing adapter observed for samples prepared with the tailed amplicon v1 (2 pool amplification) workflow amplified for either 25 or 35 PCR cycles. The system integrates an instrument, data processing software, reagents, and ScreenTape devices specific for DNA and RNA. We reasoned that reducing the concentration of the primers that were over-represented in the initial round of sequencing may improve balance. PubMed Central bioRxiv. A total of 100ng of amplicons from the ARTIC protocol were used as the input for library preparation. It is suitable to analyze size, quantity, and integrity of your samples. Target enrichment efficiency was estimated by aligning trimmed and quality filtered reads to the CLas strain Psy62 reference genome and comparing alignment rate between enriched and non-enriched samples (Table1). The RNA ScreenTape system is designed for analyzing eukaryote and Physical Specifications Signal- to- noise >3 (single peak) Measured against 2200 TapeStation System Agilent Technologies Storage Conditions Rapid, sensitive, full-genome sequencing of severe acute respiratory syndrome coronavirus 2. Chromatography & Spectroscopy Lab Supplies, GC Calculators & Method Translation Software, BioCalculators / Nucleic Acid Calculators. The mean CV of all six patient samples was 0.76 (compared to a CV of 0.61 with ARTIC v3) and 0.52 for samples with a N1 and N2 Ct of less than 30 (compared to 0.55 with the ARTIC v3 protocol; Fig. The system integrates an instrument, data processing software, reagents, and ScreenTape devices specific for DNA and RNA. Dai, Z. et al. https://doi.org/10.1016/j.cub.2020.03.022. Percentage of genome coverage at 100x at different subsampled read depths for each sample when sequenced using the following approaches: c Illumina Nextera DNA Enrichment; d ARTIC v3 with TruSeq library preparation. 22, 10111020 (2009). Not for use in diagnostic procedures. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data. Based on validation experiments for the University of Minnesota qRT-PCR clinical COVID-19 diagnostic assay, we estimate that a Ct value of 30 corresponds to roughly 500 SARS-CoV-2 genome copies and a Ct value of 35 corresponds to roughly 15 SARS-CoV-2 genome copies in the 5L input used for cDNA creation [18]. The following recipe was used to set up the PCR reactions: 2.5L template cDNA, 14.75L nuclease-free water, 5L 5x Q5 reaction buffer (New England Biolabs, Ipswich, MA), 0.5L 10mM dNTPs (Kapa Biosystems, Woburn, MA), 0.25L Q5 Polymerase (New England Biolabs, Ipswich, MA), 2L primer pool 1 or 2 (10M) for the tailed v1 protocol. Article D) Agilent Bioanalyzer trace for a library prepared from samples with N1 and N2 Ct values between ~2035 using the tailed amplicon v2 (4 pool amplification) workflow. This work was carried out in part using computing resources at the University of Minnesota Supercomputing Institute.
Prosper Mayor Accident,
How To Divide Decimals In Your Head,
Articles A
